View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7863_low_84 (Length: 270)
Name: NF7863_low_84
Description: NF7863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7863_low_84 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 19166441 - 19166653
Alignment:
| Q |
1 |
aagcgtgagggagctgcgacggttgtaaggggaagaagcggggagggagaaaaagtgtgaggttcaggaaaggcgtggtgagggataacggtgacagtgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19166441 |
aagcgtgagggagctgcgacggttgtaaggggaagaagcggggagggagaaaaagtgcgaggttcaggaaaggcgtggtgagggataacggtgatagtgg |
19166540 |
T |
|
| Q |
101 |
agctgagaaggaggttcggat-ggggtatgatgggcagcagacacagttattgaaggagggtgccggagggatggcagttccaaagaacaaggaagtcgt |
199 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19166541 |
ggctgagaaggaggttctgatgggggtatgatgggcagcagacacggttattgaaggagggtgccggagggatggcagttccaaagaacaaggaagtcgt |
19166640 |
T |
|
| Q |
200 |
cgtccttactatt |
212 |
Q |
| |
|
||||||||||||| |
|
|
| T |
19166641 |
cgtccttactatt |
19166653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 209 - 251
Target Start/End: Original strand, 19166671 - 19166713
Alignment:
| Q |
209 |
tattaaatccgtcgaattggatgaggatttggaacaacctgag |
251 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19166671 |
tattaaatccgtcgatttggatgaggatttggaacaacctgag |
19166713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University