View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7863_low_87 (Length: 259)
Name: NF7863_low_87
Description: NF7863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7863_low_87 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 17 - 123
Target Start/End: Original strand, 36947375 - 36947481
Alignment:
| Q |
17 |
acacacgcccacaaacccaccacattcatataatttatcatatttgctttcattaggctccaactagaaagaggcgaggagaaaattatcaaaatactac |
116 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36947375 |
acacacacccacaaacccaccacattcatataattcatcaaatttgctttcattaggctccaactagaaagaggcgaggagaaaattatcaaaatactac |
36947474 |
T |
|
| Q |
117 |
taaatag |
123 |
Q |
| |
|
||||||| |
|
|
| T |
36947475 |
taaatag |
36947481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 99 - 241
Target Start/End: Original strand, 36953036 - 36953180
Alignment:
| Q |
99 |
aaattatcaaaatactactaaatagttaaacctgtatgtttgaatcctttaaaa--atagtgcaagtgaatcgtttgaagctagtgtagacatatattgt |
196 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||||| |||||||| ||||| ||| | |
|
|
| T |
36953036 |
aaattctcaaagtactactaaatagttaaacctgaatgtttgaatcctttaaaacaatagtgcaagtgaatcatttgaaactagtgtacacataaattat |
36953135 |
T |
|
| Q |
197 |
tgcagttctaagttgttggaaagtgggcaaagaatagtagagaaa |
241 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
36953136 |
tgcagttttaagttgttggaaagtgggaaaagaataatagagaaa |
36953180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 119 - 167
Target Start/End: Original strand, 36947890 - 36947938
Alignment:
| Q |
119 |
aatagttaaacctgtatgtttgaatcctttaaaaatagtgcaagtgaat |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36947890 |
aatagttaaacctgtatgtttgaatcctttaaaaatagtgcaagtgaat |
36947938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University