View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7863_low_90 (Length: 249)
Name: NF7863_low_90
Description: NF7863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7863_low_90 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 7 - 249
Target Start/End: Complemental strand, 44751018 - 44750776
Alignment:
| Q |
7 |
ttggtgttgtgtctctcactgatgtaatcagagttataaggcaatctatgttatcagatgcagatgcatgaatgtgtatgatacaagcaacaatgtgtgc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44751018 |
ttggtgttgtgtctctcactgatgtaatcagagttataaggcaatctatgttatcagatgcagatgcatgaatgtgtacgatacaagcaacaatgtgtgc |
44750919 |
T |
|
| Q |
107 |
tatcttggagaaaatattgcagctatatgatcaatgttttgtttagtcaatatgtacagtctataatgttgttttaatacttgacaaaatatgaaatgct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44750918 |
tatcttggagaaaatattgcagctatatgatcaatgttttgtttagtcaatatgtacagtctataatgttgttttaatacttgactaaatatgaaatgct |
44750819 |
T |
|
| Q |
207 |
agcaggtttttgttaatacaattatcagtttttctttactgaa |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44750818 |
agcaggtttttgttaatacaattatcagtttttctttactgaa |
44750776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 9 - 62
Target Start/End: Complemental strand, 44744376 - 44744323
Alignment:
| Q |
9 |
ggtgttgtgtctctcactgatgtaatcagagttataaggcaatctatgttatca |
62 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||| ||||||||| |
|
|
| T |
44744376 |
ggtgttgtgtctctcactgatgtcattagagttataaggcaatcaatgttatca |
44744323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University