View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7863_low_94 (Length: 246)
Name: NF7863_low_94
Description: NF7863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7863_low_94 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 20 - 236
Target Start/End: Complemental strand, 41444454 - 41444237
Alignment:
| Q |
20 |
gtgatcatggtccatggagagtcagtgtagtatactttgacttaagcctgctagaaagaagcttaaaactgtttatctctttctccccttattaattctt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41444454 |
gtgatcatggtccatggagagtcagtgtagtatactttgacttaagcctgctagaaagaagcttaaaactgtttatctctttctccccttattaattctt |
41444355 |
T |
 |
| Q |
120 |
ccatcttcagaactgtatagt-nnnnnnnnntattcctatctctcttttgcaaatctacataattctaccaaaacaaaggcagtgaggcagtgtgttggg |
218 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41444354 |
ccatcttcagaactgtatagtaaaaaaaaaatattcctatctctcttttgcaaatctacataattctaccaaaacaaaggaagtgaggcagtgtgttggg |
41444255 |
T |
 |
| Q |
219 |
tatggctcacaggttctg |
236 |
Q |
| |
|
||||||||| |||||||| |
|
|
| T |
41444254 |
tatggctcataggttctg |
41444237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University