View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7863_low_98 (Length: 242)
Name: NF7863_low_98
Description: NF7863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7863_low_98 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 11 - 242
Target Start/End: Original strand, 8842977 - 8843207
Alignment:
| Q |
11 |
catcatcatcacacgctcgcttctaaatcttcaaccatggtgctcgaggtaatttccgattacaccccctctcgatttcaatttaccataacatgcatat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8842977 |
catcatcatcacacgctcgcttctaaatcttcaaccatggtgctcgaggtaatttccgattacaccccctctcgatttcaatttaccataacatgcatat |
8843076 |
T |
 |
| Q |
111 |
ttctaggnnnnnnnnaccgaattctttccttcaacaggcgactatgatctgtattgacaattctgaatggatgcgtaacggagattattctccttctcga |
210 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8843077 |
ttctagg-tttttttaccgaattcttttcttcaacaggcgactatgatctgtattgacaattctgaatggatgcgtaacggagattattctccttctcga |
8843175 |
T |
 |
| Q |
211 |
tttcaagcccaagctgatgatgtccatctcat |
242 |
Q |
| |
|
|||||||| |||||||||| ||| ||||||| |
|
|
| T |
8843176 |
tttcaagctcaagctgatgctgttaatctcat |
8843207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 227
Target Start/End: Complemental strand, 31885711 - 31885665
Alignment:
| Q |
181 |
atgcgtaacggagattattctccttctcgatttcaagcccaagctga |
227 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||| ||| |||| |
|
|
| T |
31885711 |
atgcgtaacggtgattactctccttctcgatttcaagctcaatctga |
31885665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University