View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7865_high_16 (Length: 207)
Name: NF7865_high_16
Description: NF7865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7865_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 2 - 144
Target Start/End: Complemental strand, 50651757 - 50651615
Alignment:
| Q |
2 |
tttaggaagtgtgtttcaagttttggagcaactgccgtggcatattttctgtcacgatgtggagcttgtggaagagtaggaacctgacaatttgggaaaa |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50651757 |
tttaggaagtgtgtttcaagttttggagcaactgccgtggcatatttgctgtcacgatgtggagcttgtggaagagtaggaacctgacaatttgggaaaa |
50651658 |
T |
|
| Q |
102 |
taaagtcgaaagttcagctgatgtggtttgtagaggtcgagcg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50651657 |
taaagtcgaaagttcagctgatgtggtttgtagaggtcgagcg |
50651615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University