View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7865_low_17 (Length: 240)
Name: NF7865_low_17
Description: NF7865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7865_low_17 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 109 - 240
Target Start/End: Complemental strand, 27440098 - 27439970
Alignment:
| Q |
109 |
tgttatgtatttgtttttaaaccatagacatccatcatccttgtgaacaatattttcctttaaccgtttgttatgcagcttaatatactcttgtgatata |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27440098 |
tgttatgtatttgtttttaaaccatagacatccatcatccttgtgaacaatattttcctttaaccgtttgttatgcagct---tatactcttgtgatata |
27440002 |
T |
|
| Q |
209 |
attaatttagaagctttcacatgtaatattat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
27440001 |
attaatttagaagctttcacatgtaatattat |
27439970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University