View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7865_low_19 (Length: 224)
Name: NF7865_low_19
Description: NF7865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7865_low_19 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 22036055 - 22035831
Alignment:
| Q |
1 |
attaacttggtctcccagatctctctctaactcgcattgtctcgctcacggatgaattctacaataacagaaattttcacaatattatgtcatcaaca-t |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
22036055 |
attaacttggtctcccagatctctctctaactcgcattgtctcgctcacggatgaattctacaataacagaaattttcacaatattatgtcatcaagatt |
22035956 |
T |
|
| Q |
100 |
tttttcacaaaaatgaaaacaaatgattttctgactgaattttcacccttttacgtagnnnnnnntaacgagtgcaaattctcattacaatcgatatata |
199 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22035955 |
tttttcacaaaaatgcaaacaaatgattttctgactgaattttcacccttttacgtagaaaaaaataacgagtgcaaattctcattacaatcgatatata |
22035856 |
T |
|
| Q |
200 |
aatctccggtctaaatttttgtggc |
224 |
Q |
| |
|
||||||| ||||||||||||||||| |
|
|
| T |
22035855 |
aatctcctgtctaaatttttgtggc |
22035831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University