View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7865_low_21 (Length: 202)
Name: NF7865_low_21
Description: NF7865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7865_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 2e-75; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 17 - 175
Target Start/End: Original strand, 32407852 - 32408010
Alignment:
| Q |
17 |
agaattaactcgacacgacaaacataattgttaagagatatcttccacttataaatgtttttaaagatcatatcacatcaaacgtgacactacatgaaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32407852 |
agaattaactcgacacgacaaacataattggtaagagatatcttccacttataaatgtttttaaagatcatatcacatcaaacgtgacactacaagaaaa |
32407951 |
T |
 |
| Q |
117 |
caacttattaccgatagattattgttgaagtcacgtttctgatatgattttctacctcc |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
32407952 |
caacttattaccgatagattattgttgaagtcatgtttctgaaatgattttctacctcc |
32408010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University