View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7866_high_5 (Length: 240)
Name: NF7866_high_5
Description: NF7866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7866_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 10545633 - 10545418
Alignment:
| Q |
1 |
tcgcggaacagagcgcgtgatggttacttactttaccgacctaaagtgtttctgttcatcagaggattagtggtgtttgttttgttttatccgaggtaga |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10545633 |
tcgcggaacagagcgcgtgatggtcacttactttaccgacctaaagtgtttctgttcatcagaggattagtggtgtttgttttgttttatccgaggtaga |
10545534 |
T |
|
| Q |
101 |
ttagtggtctttgttttgttttattggagatttaatgttaaccacatcgactcaatctattactaatcactaatattttaattactatagataaaaacaa |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10545533 |
ttagtggtctttgttttgttttactggagatttaatgttaaccacatcaactcaatctattactaatcactaatattttaattactatacataaaaacaa |
10545434 |
T |
|
| Q |
201 |
ataaaacttcacatta |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
10545433 |
ataaaacttcacatta |
10545418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University