View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7867_low_4 (Length: 249)
Name: NF7867_low_4
Description: NF7867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7867_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 36000614 - 36000850
Alignment:
| Q |
1 |
agtatgtatggtggaacccacttgttgatttggcaacgcaaattttctcggtttataattcaaaaagttcttcaaattgttatgatccaaaataacattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36000614 |
agtatgtatggtggaacccacttgttgatctggcaacgcaaattttctcggtttataattcaaaaagttcttcaaattgttatgatccaaaataacattt |
36000713 |
T |
|
| Q |
101 |
tatttgatacattttggcataactaaacatattagctgtgataattagagtaatgattgtcaaaagattgagggaataaacttttttctctttgatagag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36000714 |
tatttgatacattttggcataactaaacatattagctgtgataattagagtaatgattgtcaaaagattgagggaataaacttttttctctttgatagag |
36000813 |
T |
|
| Q |
201 |
taacaacgacatcaaattatttgcacttacactcttc |
237 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36000814 |
taacaacgacatcaagttatttgcacttacactcttc |
36000850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University