View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7867_low_6 (Length: 240)
Name: NF7867_low_6
Description: NF7867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7867_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 36000581 - 36000359
Alignment:
| Q |
1 |
tcaattaattaagaatgctgtgtcaagttttagcatacacaaa-tcaacttcggaaactatttggaggccactaacagcaccaaatggaatctagataaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| || |||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
36000581 |
tcaattaattaagaatgctgtgtcaagttttagcatacacaaaatcaacttcagagactatttggaggccactaacagcaacaaatggaatctagacaaa |
36000482 |
T |
 |
| Q |
100 |
gaaagttacatggaacatgtttcagaataattttcttttgaaagttcaacaaaccgtttctatgaccttacaaggttactaggggacgctgaccatatat |
199 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36000481 |
gaaaggtacatggaacatgtttcagaataattttcttttgaaagttcaacaaactgttaatatgaccttacaaggttacta-gggacgctgaccatatat |
36000383 |
T |
 |
| Q |
200 |
aatagagcagaactctgccaaagg |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36000382 |
aatagagcagaactctgccaaagg |
36000359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University