View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7868_low_14 (Length: 254)
Name: NF7868_low_14
Description: NF7868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7868_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 8354886 - 8354644
Alignment:
| Q |
18 |
cttacaacaacaaaaacaaaacagttatccatgatatatctat------------cattcccaaagcaaaaggttttaggtt-----gcaggggaagcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
8354886 |
cttacaacaacaaaaacaaaacagttatccatgatatatatatatatatatatatcattcccaaagcaaagggttttaggttaggttgcaggggaagcat |
8354787 |
T |
 |
| Q |
101 |
tagcaatgtcaatgacaaaacggtaacgaacatcattcttcacaagacgctgaaaagcttcattgattgtatcagctttgattaattcaatgtcacatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8354786 |
tagcaatgtcaatgacaaaacggtaacgaacatcattcttcaaaagacgctgaaaagcttcattgattgtatcagctttgattaattcaatgtcacatgt |
8354687 |
T |
 |
| Q |
201 |
gatattatgcttcccacaaacatccaacatttcttgagtctct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8354686 |
gatattatgcttcccacaaacatccaacatttcttgagtctct |
8354644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University