View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7869_low_8 (Length: 227)
Name: NF7869_low_8
Description: NF7869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7869_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 55 - 200
Target Start/End: Original strand, 1773089 - 1773234
Alignment:
| Q |
55 |
gttgcatggtttatatagttaatttaatacatcctttatctagttgtatatagtttgctgaaaagttcaatgtctactcgtcaaaaacactctatttgca |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
1773089 |
gttgcatggtttatatagttaatttaatacatcctttatctagttgtatatagtttgctgaaaagttcaatgtatactcatcaaaaacactctatttgca |
1773188 |
T |
 |
| Q |
155 |
agttaatggaagatagtgagactcttcaatgacgttttggtgtagg |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
1773189 |
ggttaatggaagctagtgagactcttcaatgtcgttttggtgtagg |
1773234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University