View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7871_low_12 (Length: 386)
Name: NF7871_low_12
Description: NF7871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7871_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 18 - 308
Target Start/End: Original strand, 30286185 - 30286475
Alignment:
| Q |
18 |
ccttcgtgttgctaatttgctcgaaagggaggagcctcgtgttgcttacctttgtaagtctttgaaacatcttcaaatgtgtttctcgttagttaatatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30286185 |
ccttcgtgttgctaatttgctcgaaagggaggagcctcgtgttgcttacctttgtaagtctttgaaacatcttcaaatgtgtttctcgttagttaatatg |
30286284 |
T |
|
| Q |
118 |
gtatctaattcgttttcgttagctaccttggtcattgaaactgtcttctatctattagtcagttaggtttatcagattactatgcgatacacacgatgtt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
30286285 |
gtatctaattcgttttcgttagctaccttggtcattgaaactgtcttctatctattagtcagttaggtttatcggattactatgcgatacacgcgatgtt |
30286384 |
T |
|
| Q |
218 |
gttttcataattttgatacattcaggattatagtgacaccatctcacattttagagactaaaatcactgtttaccctcttttgagcttcgt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30286385 |
gttttcataattttgatacattcaggattatagtgacaccgtctcacattttagagactaaaatcactgtttaccgtcttttgagcttcgt |
30286475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University