View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7871_low_16 (Length: 290)
Name: NF7871_low_16
Description: NF7871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7871_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 13 - 272
Target Start/End: Complemental strand, 43245069 - 43244810
Alignment:
| Q |
13 |
aatatagcatgaaccaaattactcaatactgaggcaagaggcttaaattcccatatatagtcttctaagcagcccaagtggatgaagattttggagcaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
43245069 |
aatatagcatgaaccaaattactcaagactgaggcaagaggcttaaattcccatatatagtcttctaagcagccctagtggaagaagattttggagcaat |
43244970 |
T |
 |
| Q |
113 |
gcttgtgagcctatacaagcctctctgcaccttctgaagcagagattttgtgggtgcacttgacaaagtgaaggcaattgagtccaaataccaatcacct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43244969 |
gcttgtgagcctatacaagcctctctgcaccttctgaagcagagattttgtgggtgcacttgacaaagtgaaggcaattgagtccaaataccaatcacct |
43244870 |
T |
 |
| Q |
213 |
cgtcccttaaaacccacaacctggcctccatctattgagaaagtgaatggtgtcccttct |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43244869 |
cgtcccttaaaacccacaacctggcctccatctattgagaaagtgaatggtgtcccttct |
43244810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 71 - 182
Target Start/End: Complemental strand, 39866140 - 39866039
Alignment:
| Q |
71 |
agtcttctaagcagcccaagtggatgaagattttggagcaatgcttgtgagcctatacaagcctctctgcaccttctgaagcagagattttgtgggtgca |
170 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| || |||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
39866140 |
agtcttctaagcagccttgttggatgaagattttggagcaatgctt----------acgagcctctctgcaccttatgaagcagagactttgtgggtgca |
39866051 |
T |
 |
| Q |
171 |
cttgacaaagtg |
182 |
Q |
| |
|
|| || |||||| |
|
|
| T |
39866050 |
ctagataaagtg |
39866039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University