View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7871_low_17 (Length: 250)
Name: NF7871_low_17
Description: NF7871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7871_low_17 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 16 - 250
Target Start/End: Original strand, 9669191 - 9669428
Alignment:
| Q |
16 |
atagaatgaagttttcatgttaacagaggaaaagagctcgagttcaaattagtattcaagtaaccactatgtaatgacataaaaaataaaggaccttcta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9669191 |
atagaatgaagttttcatgttaacagaggaaaagagcttgagttcaaattagtattcaagtaacagctatgtaatgacataaaaaataaaggaccttcta |
9669290 |
T |
 |
| Q |
116 |
cattgataaccttattcaattgcaaagaccacatctgtttgttcctctaaccagtccaaacattcaacacaagt---ctcatctcatccgccatgaaatc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9669291 |
cattgataaccttattcaattgcaaagaccccatctgtttgttcctctaaccagtccaaacattcaacacaagtctcctcatctcatccgccatgaaatc |
9669390 |
T |
 |
| Q |
213 |
catcatatgtgccatacgcacatctttctcatactgaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9669391 |
catcatatgtgccatacgcacatctttctcatactgaa |
9669428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University