View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7871_low_5 (Length: 448)
Name: NF7871_low_5
Description: NF7871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7871_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 273; Significance: 1e-152; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 139 - 431
Target Start/End: Complemental strand, 38623584 - 38623293
Alignment:
| Q |
139 |
tccatttgcaagtaggagaaaacatccacatttgataatagaacactaggtctgttttgtttcgcgtttggatacatacggcactgaaaacacgataaaa |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38623584 |
tccatttgcaagtaggagaaaacatccacatttgataatagaacaccaggtctgttttgtttcgcgtttggatacatacggcactgaaa-cacgataaaa |
38623486 |
T |
 |
| Q |
239 |
ctttagttcttctacaagggactaggaacagagtattattacatcatagtagtactgtactacacaactgaagattatggtgcagcacttgagaatcaaa |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38623485 |
ctttagttcttctacaagggactaggaacagggtattattacatcatagtagtactgtactacacaactgaagattatggtgcagcacttgagaatcaaa |
38623386 |
T |
 |
| Q |
339 |
cgaacattgttaggatcagcttcctctactgctcactcttcaggtcatcttctatcatataagtataactcatttcattcttcttgttgatgt |
431 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38623385 |
cgaacattgttaggatcagcttcctctactgctcactcttcaggtcatcttctatcatataagtataactcatttcattcttcttgtttatgt |
38623293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 11 - 93
Target Start/End: Complemental strand, 38623712 - 38623630
Alignment:
| Q |
11 |
tgagacggttacacccacccacagttcatatgtttatgttttcgtcacataaataatttattttacatttaacttccgtcaag |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38623712 |
tgagacggttacacccacccacagttcatatgtttatgttttcgtcacataaataatttattttacatttaacttccgtcaag |
38623630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University