View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7872_high_6 (Length: 280)
Name: NF7872_high_6
Description: NF7872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7872_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-121; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 20 - 267
Target Start/End: Original strand, 18590346 - 18590596
Alignment:
| Q |
20 |
tttcttattgttctagcgttgggactgttttcatgttcagttcaatccatgaggtttgatttgcaacctggagttgctagatgctttgctgaaaacatga |
119 |
Q |
| |
|
|||||| || ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18590346 |
tttcttctttttctagctgtgggactgttttcatgttcagttcaatccatgaggtttgatttgcaacctggagttgctagatgctttgctgaaaacatga |
18590445 |
T |
|
| Q |
120 |
agaattatttgatgacatttggcaactattccattgtcaatcccaaagaaaaccagaccctcaccgttcgggtat---gtcgattcatttatactagtgc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18590446 |
agaattatttgatgacatttggcaactattccattgtcaatcccaaagaaaaccagaccctcaccgttcgggtatgtcgtcgattcatttatactagtgc |
18590545 |
T |
|
| Q |
217 |
tgaaatgaaatatgagcaaaacgtcaaatgtattttatatatgtttcttct |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18590546 |
tgaaatgaaatatgagcaaaacgtcaaatgtattttatatatgtttcttct |
18590596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 141
Target Start/End: Original strand, 18585061 - 18585182
Alignment:
| Q |
20 |
tttcttattgttctagcgttgggactgttttcatgttcagttcaatccatgaggtttgatttgcaacctggagttgctagatgctttgctgaaaacatga |
119 |
Q |
| |
|
|||||| |||||||| | | ||| ||||| |||||| |||||||||||||||||||||||||||| |||||||| |||||||| |||||||| |||| | |
|
|
| T |
18585061 |
tttcttcttgttctaatggtaggattgtttacatgtttagttcaatccatgaggtttgatttgcaaactggagttactagatgcattgctgaagacatca |
18585160 |
T |
|
| Q |
120 |
agaattatttgatgacatttgg |
141 |
Q |
| |
|
|||| ||| ||||||| |||| |
|
|
| T |
18585161 |
agaaaaattcgatgacaattgg |
18585182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 17 - 83
Target Start/End: Original strand, 18606376 - 18606442
Alignment:
| Q |
17 |
ctttttcttattgttctagcgttgggactgttttcatgttcagttcaatccatgaggtttgatttgc |
83 |
Q |
| |
|
||||||||| ||||| |||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18606376 |
ctttttcttcttgttgtagctatgggactgttttcattttcagttcaatccatgaggtttgatttgc |
18606442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University