View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7872_low_11 (Length: 261)
Name: NF7872_low_11
Description: NF7872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7872_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 161 - 244
Target Start/End: Original strand, 13887395 - 13887476
Alignment:
| Q |
161 |
ctcagtggatagaattacattcattagatgttttccttgcttttcatgatatagtttaagaacatgcgtttttctatcacaact |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13887395 |
ctcagtggatagaattacattcattagatgttct--tggcttttcatgatatagtttaagaacatgcgtttttctatcacaact |
13887476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 13 - 74
Target Start/End: Original strand, 13887174 - 13887235
Alignment:
| Q |
13 |
aatatctggcatatgcaagtgttcaatgtgtcttcaaactccttctttcaatgcagttttta |
74 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13887174 |
aatatctggcatatgcaagtgttcaacgtgtcttcaaactccttctttcaatgcagttttta |
13887235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University