View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7872_low_8 (Length: 301)
Name: NF7872_low_8
Description: NF7872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7872_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 88 - 272
Target Start/End: Complemental strand, 505299 - 505118
Alignment:
| Q |
88 |
aggtagaatgtgatatagttttgtagagtttgtgcacattgttagttatgttttaatttttgttgtaaatcaggtatcgtctgtgcatgattttaaagac |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
505299 |
aggtagaatgtgatatagttttgtagagtttgtgcacat-gttagttatgttttaatttttgttgtaaatcaggtatcgtctgcgcatgactttaaagac |
505201 |
T |
 |
| Q |
188 |
tatttctttgacttagatatatgatcacaattgacggtgaagttctctttaagttttaatgttactgcattcacatagtgaattg |
272 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
505200 |
tatttctttgacctag--atatgatcacaattgacggtgaagttctctttaagttttaatgttactgcattcacatagtgaattg |
505118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University