View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7873_high_1 (Length: 360)
Name: NF7873_high_1
Description: NF7873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7873_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 19 - 349
Target Start/End: Original strand, 194984 - 195316
Alignment:
| Q |
19 |
ctcaggagcaggttcttgcacaccggtcaatcgcttgctttgttactcactgtggctggaactcgttgatggaggctattgcctctggagtgccggttgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
194984 |
ctcaggagcaggttcttgcacaccggtcaatcgcttgctttgttactcactgtggctggaactcgtcgatggaggctattgcctctggagtgccggttgt |
195083 |
T |
 |
| Q |
119 |
ggcgttcccacaatggggtgaccaagtgacgaatgccaagt--acttggttgatgtgtatggagttgggattggaatgtgcaagggtgaagctgcaaacg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
195084 |
ggcgttcccacaatggggtgaccaagtgacgaatgccaagtgtacttggttgatgtgtatggagttgggattggaatgtgcaagggtgaagctgcaaacg |
195183 |
T |
 |
| Q |
217 |
aattgataaacagagatgaggtcaacaagtgtttgttggaggcaactgttggaaccaaggcaaaggagataaagcaaaatgtgctcagcttgaaggcggc |
316 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
195184 |
aattgataaacagagatgaggttaacaagtgtttgttggaggcaactgttggaaccaaggcaaaggagataaagcaaaatgtgctcagcttgaaggcggc |
195283 |
T |
 |
| Q |
317 |
agcggaagctgctattagagatggtggttcttc |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
195284 |
agcggaagctgctattagagatggtggttcttc |
195316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University