View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7873_low_3 (Length: 447)
Name: NF7873_low_3
Description: NF7873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7873_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 19 - 438
Target Start/End: Complemental strand, 22421979 - 22421560
Alignment:
| Q |
19 |
gatctcaaccgtcggattcatgatcagaaaatggcgtcggagattttcaacatgccggtggaggattgggataaatggggggataattttgagaaaccgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |||||||| |||||||||| |
|
|
| T |
22421979 |
gatctcaaccgtcggattcatgatcagaaaatggcgtcggagattttcaacatgccggtgaaggattgggatgaatggggagataatttcgagaaaccgt |
22421880 |
T |
|
| Q |
119 |
ttggtgaagggagtttgtcgggttcgacgagtcggaacgatgatagtccggttgttagggtttattttaagggtttagtgagtgaggaggttgtgagagg |
218 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||| |||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22421879 |
ttggtgaagggagttcttcgggttcgacgatgcggaacaatgaaggtccggttgttagggtttattttaagggtttagtgagtgaggagagtgtgagagg |
22421780 |
T |
|
| Q |
219 |
tgagaatgtttctttggctgggattggtgttgctgtttgtgatgatgaggataatttgatattggaaatttctaaggctgttgttgggaatgaaagtagg |
318 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| ||| | |
|
|
| T |
22421779 |
tgagagtgtttctttggctgggattggtgttgctgtttgtgatgatgaggataatttgatattggaaatttctaagactgttgatgggaatgagagtcgt |
22421680 |
T |
|
| Q |
319 |
aaaattgttgtggagcttatggctttgattgaaggtttcaatgctgttattgctttggatttgaagcgtgttatttattttggtgattattatacacttt |
418 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22421679 |
aaaattgctgtggagcttatggctttgattgaaggtttcaatgctgttattgctttggatttgaagcgtgttatttattttggtgattattatacacttt |
22421580 |
T |
|
| Q |
419 |
ttcaacatgtgagttcttct |
438 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
22421579 |
ttcaacatgtgagttcttct |
22421560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University