View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7874_high_11 (Length: 301)
Name: NF7874_high_11
Description: NF7874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7874_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 15 - 282
Target Start/End: Original strand, 30167725 - 30167974
Alignment:
| Q |
15 |
gaagaatgaagttgggccactataagagaaacaatacatttataacttagaattggatatgccgctgttgggatatcaattcacttggttcaaaagtatc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30167725 |
gaagaatgaagttgggccactataagagaaacaatacatttataacttagaattggatatgccgctgttgggatatcaattcacttggttcaaaagtatc |
30167824 |
T |
|
| Q |
115 |
ggtactgaagcatccaaggaagcccgtctagacagagctcttgtttcaaactcgtggcaaagcatgtttcctaatgctgcctttcagactctcgttgctc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30167825 |
ggtactgaagcatccaaggaagcccgtctagacagagctcttgtttcaaactcgtggcaaagcatgtttcctaatgctgcctttcagactctcgttgct- |
30167923 |
T |
|
| Q |
215 |
caatttccctcgttgctccaatttccgatcatactcctctccttctgcagctcgaccccatcccatgg |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30167924 |
-----------------ccaatttccgatcatactcctctccttctgcagctcgaccccatcccatgg |
30167974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 70 - 221
Target Start/End: Complemental strand, 12354236 - 12354085
Alignment:
| Q |
70 |
gatatgccgctgttgggatatcaattcacttggttcaaaagtatcggtactgaagcatccaaggaagcccgtctagacagagctcttgtttcaaactcgt |
169 |
Q |
| |
|
|||||||||||||||||||| ||||| || ||||| || ||| | |||||| | ||||| |||||||| || |||| |||| ||||| || ||| | |
|
|
| T |
12354236 |
gatatgccgctgttgggataccaatttacatggtttaagagtgttggtactaatgcatctaaggaagcgcgcttagatcgagcccttgtcacaccctcat |
12354137 |
T |
|
| Q |
170 |
ggcaaagcatgtttcctaatgctgcctttcagactctcgttgctccaatttc |
221 |
Q |
| |
|
|||||| ||||||||| ||||| || |||||||||| |||||||||||||| |
|
|
| T |
12354136 |
ggcaaaacatgtttccaaatgcagcacttcagactcttgttgctccaatttc |
12354085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 70 - 221
Target Start/End: Original strand, 23147850 - 23148001
Alignment:
| Q |
70 |
gatatgccgctgttgggatatcaattcacttggttcaaaagtatcggtactgaagcatccaaggaagcccgtctagacagagctcttgtttcaaactcgt |
169 |
Q |
| |
|
|||||||||||||||||||| || || || ||||| || ||| | |||||||| ||||| |||||||| ||| |||| ||||| ||||| || ||| | |
|
|
| T |
23147850 |
gatatgccgctgttgggataccagtttacatggtttaagagtgttggtactgatgcatctaaggaagcgcgtttagatagagcccttgtcacaccctcat |
23147949 |
T |
|
| Q |
170 |
ggcaaagcatgtttcctaatgctgcctttcagactctcgttgctccaatttc |
221 |
Q |
| |
|
|||||| ||||||||| ||||| || |||||||||| |||||||||||||| |
|
|
| T |
23147950 |
ggcaaaacatgtttccgaatgcagcacttcagactcttgttgctccaatttc |
23148001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University