View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7874_low_12 (Length: 322)
Name: NF7874_low_12
Description: NF7874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7874_low_12 |
 |  |
|
| [»] scaffold0047 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0047 (Bit Score: 119; Significance: 9e-61; HSPs: 2)
Name: scaffold0047
Description:
Target: scaffold0047; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 166 - 305
Target Start/End: Complemental strand, 11001 - 10862
Alignment:
| Q |
166 |
tgtttgttctcttggggaaatggaagataaaagtgaaacatgtaagctttgatgaaatcttagagattcacagttcgtaaaaattgaattaacaagtcag |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11001 |
tgtttgttctcttggggaaatggaagataaaagtgaaacatgtaagctttgatgaaatcttagagattcacagttcgtaaaaattgaattaacaagtcag |
10902 |
T |
 |
| Q |
266 |
agatnnnnnnntaaaatccccttgtgatctgtctgaaaac |
305 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
10901 |
agataaaaaaataaaatccccttgtgatctgtctgaaaac |
10862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0047; HSP #2
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 7 - 119
Target Start/End: Complemental strand, 11160 - 11048
Alignment:
| Q |
7 |
aatatcttcggtcattaggctactattaattaaatttaaacatgatacggtaatttcatatacacagataaattccagaagtttgaaatcactaagatgc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11160 |
aatatcttcggtcattaggctactattaattaaatttaaacaagatacggtaatttcatatacacagataaattccagaagtttgaaatcactaagatgc |
11061 |
T |
 |
| Q |
107 |
ctttggtcaacat |
119 |
Q |
| |
|
||||||||||||| |
|
|
| T |
11060 |
ctttggtcaacat |
11048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University