View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7874_low_7 (Length: 385)
Name: NF7874_low_7
Description: NF7874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7874_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 9 - 379
Target Start/End: Original strand, 40576102 - 40576472
Alignment:
| Q |
9 |
gaagaatatatagtttcaccaggaaaaggagaggttagtaaatccgctgtcagttaatgtagtctgcaaatcttttgttccttacaaagtacaagtgctt |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
40576102 |
gaagaaaatatagtttcaccaggaaaaggagaggttagtaaatctgctgtcagttaatgtagtctgcaaatcttttgttcttcacaaagtacaagtgctt |
40576201 |
T |
 |
| Q |
109 |
gcttgatctcttagtggaagatccaaattcagatttcatgattttatgcagatattaattgacaataaacaacactataaaatcttggggaaggatatag |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40576202 |
gcttgatctcttagtggaagatccaaattcatatttcatgattttatgcagatattaattgacaataaacaacactataaaatcttggggaaggatatag |
40576301 |
T |
 |
| Q |
209 |
atatggtatcgctaatcaagttgtctgttgaggagggtaaagttgttcgccacgaggactggtatgtattattaatccccttaaatttctgttctttttt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40576302 |
atatggtatcgctaatcaagttgtctgttgaggagggtaaagttgttcgccacgaggactggtatgtattattaatccccttaaccttctgttctttttt |
40576401 |
T |
 |
| Q |
309 |
ggaaaatgtaacggaagagttggaaagacatggaataaaaccttcaaaggaaaaacttttgctaaactatt |
379 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40576402 |
ggaaaatgtaagggaagagttagaaagacatggaataaaaccttcaaaggaaaattttttgctaaactatt |
40576472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University