View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7875_low_6 (Length: 207)
Name: NF7875_low_6
Description: NF7875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7875_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 41 - 190
Target Start/End: Original strand, 23087136 - 23087288
Alignment:
| Q |
41 |
tgttttgttgtttaattgtaagttttatgttttgctgttttacttctagactaatggatatttcttgaattacagatctgcaaatctgactccaagcaca |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23087136 |
tgttttgttgtttaattgtaagttttatgttttgctgtattacttctagactaatggatatttcttgaattacagatctgcaaatctgactccaagcaca |
23087235 |
T |
|
| Q |
141 |
tactccgtacacgcaagtatg---gtatatgatgataatgaaattggagatat |
190 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
23087236 |
tactccgtacacgcaagtatggtagtagatgatgataatgaaattggagatat |
23087288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 76 - 141
Target Start/End: Original strand, 24022785 - 24022849
Alignment:
| Q |
76 |
tgttttacttctagactaatggatatttcttgaattacagatctgcaaatctgactccaagcacat |
141 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| || ||||||| | ||||||||||||| |
|
|
| T |
24022785 |
tgttttacttctagactaatggatattt-ttgaattataggtctgcaagaccaactccaagcacat |
24022849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 112
Target Start/End: Complemental strand, 11338281 - 11338232
Alignment:
| Q |
62 |
gttttatgttttgctgttttacttctagactaatggatatttcttgaatta |
112 |
Q |
| |
|
||||||||||||| |||||||||||||| || |||||||||| |||||||| |
|
|
| T |
11338281 |
gttttatgttttgttgttttacttctagtcttatggatattt-ttgaatta |
11338232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 122
Target Start/End: Complemental strand, 11356844 - 11356785
Alignment:
| Q |
62 |
gttttatgttttgctgttttacttctagactaatggatatttcttgaattacagatctgca |
122 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||| ||||||| |||||||| || |||||| |
|
|
| T |
11356844 |
gttttatgttttgttgttttacttctaacctaattgatattt-ttgaattataggtctgca |
11356785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University