View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7876_high_5 (Length: 390)
Name: NF7876_high_5
Description: NF7876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7876_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 8e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 295 - 372
Target Start/End: Complemental strand, 50337645 - 50337568
Alignment:
| Q |
295 |
ggaacctttcgatatttacttagttatggtcaattagctagcattagcacacacactacaaaaactcagtttggtaaa |
372 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50337645 |
ggaacctttcgacatttacttagttatggtcaattagctagcattagcacacacactacaaaaactcagtttggtaaa |
50337568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University