View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7876_low_10 (Length: 272)
Name: NF7876_low_10
Description: NF7876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7876_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 52 - 167
Target Start/End: Original strand, 39708759 - 39708893
Alignment:
| Q |
52 |
atttccgttctacaacactcgaggattagtttgtgcaagttatgtgaagata-------------------ataatacgacgttgaatgtgcctcttttt |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
39708759 |
atttccgttctacaacactcgaggattagtttgtgcaagttatatgaagatactcaatttatataaaaataataatacgacattgaatgtgcctcttttt |
39708858 |
T |
|
| Q |
133 |
ctacttaactgcatactaattttgtgcgatttgtg |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
39708859 |
ctacttaactgcatactaattttgtgcgatttgtg |
39708893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University