View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7876_low_12 (Length: 265)
Name: NF7876_low_12
Description: NF7876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7876_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 15 - 174
Target Start/End: Original strand, 56004593 - 56004752
Alignment:
| Q |
15 |
tatgaaatgagaaaacgtgtcaagtatatatgatgaagctatactagagcctagaaatagaaggatgagccggcttggccggcctgttagcatctcttca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56004593 |
tatgaaatgagaaaacgtgtcaagtatatatgatgaagctatactagagcctagaagtagaaggatgagccggcttggccggcctgttagcatctcttca |
56004692 |
T |
|
| Q |
115 |
aattgcttcacgaaaccaattcacacattttctctctaatttaatcgttactatttaata |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
56004693 |
aattgcttcacgaaaccaattcacacattttctctttaatctaatcgttactatttaata |
56004752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 173 - 251
Target Start/End: Original strand, 56004780 - 56004858
Alignment:
| Q |
173 |
tatgttttatcgaagaatgagttgttcaagagaagtgagttcgaattttagatggaacaattttttattagattttatt |
251 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
56004780 |
tatgttttatcgaagaacgagttgttcaagagaagtgagttcgaattttaggtggaacaattttttattaaattttatt |
56004858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University