View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7877_high_29 (Length: 202)

Name: NF7877_high_29
Description: NF7877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7877_high_29
NF7877_high_29
[»] chr1 (1 HSPs)
chr1 (1-183)||(51254767-51254949)


Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 183
Target Start/End: Complemental strand, 51254949 - 51254767
Alignment:
1 ataaagaaaaaatgtattaacaaattaagctgataagacagaaaataacttggttattaatattctctataattaatcataatcataaactataataata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51254949 ataaagaaaaaatgtattaacaaattaagctgataagacagaaaataacttggttattaatattctctataattaatcataatcataaactataataata 51254850  T
101 ccatgaggaatgagagagacagtgagaggaagtgtgatcaaggctttcctgccataccggtcagacaaattcccaattagtgg 183  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
51254849 ccttgaggaatgagagagacagtgagaggaagtgtgatcaaggctttcctgccgtaccggtcagacaaattcccaattagtgg 51254767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University