View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7877_high_4 (Length: 433)
Name: NF7877_high_4
Description: NF7877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7877_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 295; Significance: 1e-165; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 92 - 417
Target Start/End: Complemental strand, 32726586 - 32726252
Alignment:
| Q |
92 |
ggatgaggaagaagaagaaatggaaacaacaac---------aacaacgacaataaaaacgcaagaagttggtgatgattcaaaagggctaaaactagtg |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726586 |
ggatgaggaagaagaagaaatggaaacaacaaccacaacaacaacaacggcaataaaaacgcatgaagttggtgatgattcaaaagggctaaaactagtg |
32726487 |
T |
|
| Q |
183 |
cacctattgatggctggcgcggaagccttaaccggttcaaccaaaaaccgtgacttagctcgagtgatattgatccggctcaaggaattagtctcacaac |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726486 |
cacctattgatggctggcgcggaagccttaaccggttcaaccaaaaaccgtgacttagctcgagtgatattgatccggctcaaggaattagtctcacaac |
32726387 |
T |
|
| Q |
283 |
atgctaacggctccaacatggagagacttgccgctcatttcaccgaagcccttcatggactactagaaggtgctgggggtgcgcataataaccaccatca |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726386 |
atgctaacggctccaacatggagagacttgccgctcatttcaccgaagcccttcatggactactagaaggtgctgggggtgcgcataataaccaccatca |
32726287 |
T |
|
| Q |
383 |
ccacaacaacaacaaacattacctcaccacaaatg |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726286 |
ccacaacaacaacaaacattacctcaccacaaatg |
32726252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 6 - 61
Target Start/End: Complemental strand, 32726672 - 32726617
Alignment:
| Q |
6 |
atggacatcatcatcgaggacagaacaactgtcctcgaacagctcagtccatctat |
61 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726672 |
atggacaccatcatcgaggacagaacaactgtcctcgaacagctcagtccatctat |
32726617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University