View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7877_low_11 (Length: 306)
Name: NF7877_low_11
Description: NF7877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7877_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 247
Target Start/End: Complemental strand, 21476476 - 21476248
Alignment:
| Q |
18 |
tttttacaaccaagtacgataacaataaactctccctcactgaaagacaccgatcctgaactatggctttgcctcgatgccgtcgtgttacaatggatat |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
21476476 |
tttttacaaccaagtatgataacaataaactctccctcactgaaagacaccgatcctgaactctggcttcgcctcaatgccgtcgtgttacaatggatat |
21476377 |
T |
 |
| Q |
118 |
tcggcacgatttctaatgaccttctcaataccatcattgaacatgattcaagggcggaacttacttggaataggtttgtttgacatcttctatgacaaca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21476376 |
acggcacgatttctaatgaccttctcaataccatcattgaacatgattcaagggtggaacttgcttggaatagg-ttgtttgacatcttctatgacaaca |
21476278 |
T |
 |
| Q |
218 |
aaagttctagggctctttaccttgaacaag |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21476277 |
aaagttctagggctctttaccttgaacaag |
21476248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 179 - 209
Target Start/End: Complemental strand, 21476233 - 21476203
Alignment:
| Q |
179 |
tacttggaataggtttgtttgacatcttcta |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21476233 |
tacttggaataggtttgtttgacatcttcta |
21476203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 8 - 45
Target Start/End: Original strand, 27513581 - 27513618
Alignment:
| Q |
8 |
tgagatgaactttttacaaccaagtacgataacaataa |
45 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27513581 |
tgagatgaactttttacaaccaagtatgataacaataa |
27513618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University