View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7879_low_1 (Length: 480)
Name: NF7879_low_1
Description: NF7879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7879_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 272; Significance: 1e-152; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 154 - 465
Target Start/End: Original strand, 15996543 - 15996854
Alignment:
| Q |
154 |
aatgagaaattgtagaccattgtatgggaattcggaaatggaacatggtacacttgcattcattaatgaaaacgaaatttataaaactcaccagaacaat |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15996543 |
aatgagaaattgtagaccattgtatgggaattcggaaatggaacatggtacacttgcattcattaatgaaaacgaaatttataaaactcaccagaacaat |
15996642 |
T |
 |
| Q |
254 |
gtccgtaccaaaagcacatgccatgttaatctttaagccaagataagaatcatctatgcctttaataataatgcagctgcatgtgttgctcttgatggct |
353 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15996643 |
gtccgtaccaaaagcacatgcaatgttaatctttaagccaagataagaatcatctatgcctttaataataatgcagctgcatgtgttgctcttgatggct |
15996742 |
T |
 |
| Q |
354 |
tgtatgagaccgctgaaacaatcgagtctaggtgctatggcactgccaccaaaatataacaggcagacgtgttgcaatacttgtgattgttcagcgtttt |
453 |
Q |
| |
|
||| ||||||||||||||||||||||| |||||||||||||||| ||| |||||||| ||||||||| || |||||||||||||||||||||||| ||| |
|
|
| T |
15996743 |
tgtgtgagaccgctgaaacaatcgagtgtaggtgctatggcactaccatcaaaatatgacaggcagatgtactgcaatacttgtgattgttcagcgcttt |
15996842 |
T |
 |
| Q |
454 |
ctgtttctcttg |
465 |
Q |
| |
|
|||||||||||| |
|
|
| T |
15996843 |
ctgtttctcttg |
15996854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 99 - 154
Target Start/End: Original strand, 15996444 - 15996500
Alignment:
| Q |
99 |
ggacctcaagtatttt-ttcactttcctactttgaaacatcaacattggcagtctta |
154 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
15996444 |
ggacctcaagtatttttttcactttcatactttgaaagatcaacattggcagtctta |
15996500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 8 - 51
Target Start/End: Original strand, 15996352 - 15996395
Alignment:
| Q |
8 |
acattattctgtaagaacaagaagaaagagaaatctccattggc |
51 |
Q |
| |
|
|||| ||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
15996352 |
acatgattttgtaagaacaagaagacagagaaatctccattggc |
15996395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 337 - 399
Target Start/End: Complemental strand, 15614061 - 15613999
Alignment:
| Q |
337 |
tgttgctcttgatggcttgtatgagaccgctgaaacaatcgagtctaggtgctatggcactgc |
399 |
Q |
| |
|
||||| |||||| |||||| |||||||||||| |||||| |||||||||||| |||||||| |
|
|
| T |
15614061 |
tgttgttcttgacggcttgcatgagaccgctgcaacaatttggtctaggtgctacggcactgc |
15613999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University