View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7879_low_3 (Length: 270)
Name: NF7879_low_3
Description: NF7879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7879_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 48651652 - 48651863
Alignment:
| Q |
1 |
aactagaatcatcttccttttgtcatattcaaaaagctcaaacccccctaaattttcaggcacaaaatccaaaatcaaaaccaagactaaattaaacttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48651652 |
aactagaatcatcttccttttgtcatattcaaaaagctcaaacccccctaaattttcaggcacaaaatccaaaatcaaaaccaagactaaattaaacttt |
48651751 |
T |
 |
| Q |
101 |
aattcacaaatcaaagtaacataccatcggatgtgattgaataaacagnnnnnnngttgcgtttcaattgaagaaagtaacaaaaaagtttaggtatttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48651752 |
aattcacaaatcaaagtaacataccagcggatgtgattgaataaacagtttttttgttgcgtttcaattgaagaaagtaacaaagaagtttaggtatttt |
48651851 |
T |
 |
| Q |
201 |
gagtttttgaga |
212 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
48651852 |
gactttttgaga |
48651863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University