View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7879_low_5 (Length: 230)
Name: NF7879_low_5
Description: NF7879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7879_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 114 - 216
Target Start/End: Complemental strand, 48718084 - 48717982
Alignment:
| Q |
114 |
cagatgacgtttatttacacaataatcacctgagagtgtatgtgtatggagtgagaattccggaagggtcttttgcagctaatcctactgttgttctctc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48718084 |
cagatgacgtttatttacacaataatcacctgagagtgtatgtgtatggagtgagaattccggaagggtcttttgcagctaatcctactgttgttctctc |
48717985 |
T |
 |
| Q |
214 |
tgc |
216 |
Q |
| |
|
||| |
|
|
| T |
48717984 |
tgc |
48717982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 48718182 - 48718141
Alignment:
| Q |
1 |
ttgatgtaaacatcatccggtcctgtgtttctgcatggtttt |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48718182 |
ttgatgtaaacatcatccggtcctgtgtttctgcatggtttt |
48718141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University