View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7880_high_10 (Length: 255)
Name: NF7880_high_10
Description: NF7880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7880_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 55095076 - 55095311
Alignment:
| Q |
1 |
tggttggaaacgagcaaggattcaacaagtttgtggaccacaaatttcatgagctggataaggacagagatggtaagctctccttgaaggagcttgagcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55095076 |
tggttggaaacgagcaaggattcaacaagtttgtggaccacaaatttcatgagctggataaggacagagatggtaagctctccttgaaggagcttgagcc |
55095175 |
T |
 |
| Q |
101 |
cgctgttgctgacatcggtgctgctcttggtttgcctgctcagggcactactcctgactctgatcacatctactatcaggtaattaacctttctcttttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55095176 |
cgctgttgctgacatcggtgctgctcttggtttgcctgctcagggcactactcctgactctgatcacatctactatcaggtaattaacctttctcttttt |
55095275 |
T |
 |
| Q |
201 |
attattatgtaatgtctaattaatgtgtgtgttagt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
55095276 |
attattatgtaatgtctaattaatgtgtgtgttagt |
55095311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 172
Target Start/End: Complemental strand, 28896877 - 28896807
Alignment:
| Q |
102 |
gctgttgctgacatcggtgctgctcttggtttgcctgctcagggcactactcctgactctgatcacatcta |
172 |
Q |
| |
|
|||||| |||| || ||| ||||||||||||| |||||| | ||||||| |||||| |||||||||||||| |
|
|
| T |
28896877 |
gctgtttctgatattggttctgctcttggtttacctgctaaaggcactaatcctgattctgatcacatcta |
28896807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University