View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7880_low_13 (Length: 202)
Name: NF7880_low_13
Description: NF7880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7880_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 6e-39; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 101 - 186
Target Start/End: Complemental strand, 11346259 - 11346174
Alignment:
| Q |
101 |
ggacaaattgttttgcttttgttagggttaacacttcaacctaaaccgccgaactcagaaacccttccaaaggttgaagaagataa |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11346259 |
ggacaaattgttttgcttttgttagggttaacacttcaacctaaaccgccgaactcggaaacccttccaaaggttgaagaagataa |
11346174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 34 - 72
Target Start/End: Complemental strand, 11360680 - 11360642
Alignment:
| Q |
34 |
aaacacctgggccatttacaactttggcccactgcacaa |
72 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
11360680 |
aaacgcctaggccatttacaactttggcccactgcacaa |
11360642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University