View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7880_low_4 (Length: 370)
Name: NF7880_low_4
Description: NF7880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7880_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 227 - 335
Target Start/End: Original strand, 5024447 - 5024555
Alignment:
| Q |
227 |
ttttatctttgtattgtgtaaacttctttgattgtaatgtaatgattatttcaatataattgtcgtatcaagtttttgcttaggatatttatgtaatctc |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5024447 |
ttttatctttgtattgtgtaaacttctttgattgtaatgtaatgattatttcaatataattgtcgtatcaagtttttgcttaggatatttatgtaatctt |
5024546 |
T |
|
| Q |
327 |
tttggtaat |
335 |
Q |
| |
|
||||||||| |
|
|
| T |
5024547 |
tttggtaat |
5024555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 16 - 235
Target Start/End: Original strand, 5023797 - 5024018
Alignment:
| Q |
16 |
tataaaatcactccatcgcattcatgtctccttaatcaccggaacctcacccgaacccagcatctctgtcc--agcaccacgctgaaatcacgacaggga |
113 |
Q |
| |
|
||||||||||| |||| | ||| ||||||||||||||| ||| |||| || |||||||| || ||||| |||||||||| | |||||| | ||| | |
|
|
| T |
5023797 |
tataaaatcaccccattgttttcttgtctccttaatcactggagtctcatccacacccagcaactttgtcctcagcaccacgccgtaatcacaagaggta |
5023896 |
T |
|
| Q |
114 |
cccccaccgcgacacatcgtcttccctgagatgtcatcggcaactttttcatattatttttaatttattagatcgnnnnnnncttttttactgttat-ga |
212 |
Q |
| |
|
|| || | |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |||||||| || |
|
|
| T |
5023897 |
tgttcatcgtgtcacatcatcttccctgagatgtcatcggcaactttttcatattatttttaatttattaaatcg-aaaaaactttttgactgttatgga |
5023995 |
T |
|
| Q |
213 |
aacatatgtcatatttttatctt |
235 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5023996 |
aacatatgtcatatttttatctt |
5024018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University