View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7880_low_5 (Length: 338)
Name: NF7880_low_5
Description: NF7880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7880_low_5 |
 |  |
|
| [»] scaffold0061 (2 HSPs) |
 |  |  |
|
| [»] scaffold0203 (1 HSPs) |
 |  |  |
|
| [»] scaffold0234 (2 HSPs) |
 |  |  |
|
| [»] scaffold0433 (1 HSPs) |
 |  |  |
|
| [»] scaffold0657 (1 HSPs) |
 |  |  |
|
| [»] scaffold1383 (1 HSPs) |
 |  |  |
|
| [»] scaffold1199 (1 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
| [»] scaffold0390 (1 HSPs) |
 |  |  |
|
| [»] scaffold0220 (1 HSPs) |
 |  |  |
|
| [»] scaffold0705 (1 HSPs) |
 |  |  |
|
| [»] scaffold0213 (1 HSPs) |
 |  |  |
|
| [»] scaffold0063 (1 HSPs) |
 |  |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0061 (Bit Score: 121; Significance: 6e-62; HSPs: 2)
Name: scaffold0061
Description:
Target: scaffold0061; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 104 - 258
Target Start/End: Original strand, 4811 - 4967
Alignment:
| Q |
104 |
aacttgtgaaactcctttcacaaataaaaataaataaactatatacacagaattcagaattcaccgtataactcaatttatttattta--nnnnnnnaat |
201 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4811 |
aactggtgaaactcctttcacaaataaaaataaataaactatatacacagaattcagaattcaccgtataactcaatttatttatttatttttttttaat |
4910 |
T |
 |
| Q |
202 |
aattaaaactaaacacatgattatcgctcttgaatgatattcacaaattaataaatt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4911 |
aattaaaactaaacacatgattatcgctcttgaatgatattcacaaattaataaatt |
4967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0061; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 258 - 322
Target Start/End: Original strand, 5045 - 5110
Alignment:
| Q |
258 |
tctgataccactgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||| ||||| || |||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
5045 |
tctgataccactgatgggatatttagaggggttttttaaaattttaatcctctttgcggaagaaat |
5110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 61; Significance: 4e-26; HSPs: 19)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 258 - 322
Target Start/End: Original strand, 10627263 - 10627327
Alignment:
| Q |
258 |
tctgataccactgaagggattttaagaggggtttttcaaaattttaatccttttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10627263 |
tctgataccactgaagggattttaagaggggtttttcaaaattttaatccttttgcgtaagaaat |
10627327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 258 - 322
Target Start/End: Complemental strand, 26964927 - 26964864
Alignment:
| Q |
258 |
tctgataccactgaagggattttaagaggggtttttcaaaattttaatccttttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
26964927 |
tctgataccactgaagggattttaagaggggtttttcaaaattttaatcc-tctgcggaagaaat |
26964864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 258 - 322
Target Start/End: Complemental strand, 18263571 - 18263505
Alignment:
| Q |
258 |
tctgataccactgaagggattttaagaggggt-ttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
18263571 |
tctgataccactgaagggattttaagaggggttttttcaaaattttaatcctctttgcggaagaaat |
18263505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 268 - 322
Target Start/End: Original strand, 10620167 - 10620222
Alignment:
| Q |
268 |
ctgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10620167 |
ctgaagggattttaagaggggtttttcaaaattttaatcctctttgcggaagaaat |
10620222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 269 - 322
Target Start/End: Original strand, 28392002 - 28392056
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28392002 |
tgaagggattttaagaggggtttttcaaaattttaatcctctttgcggaagaaat |
28392056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 268 - 322
Target Start/End: Original strand, 10825188 - 10825243
Alignment:
| Q |
268 |
ctgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
10825188 |
ctgaagggattttaagaggggtttttcaaaattttaatcctctttgcggaataaat |
10825243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 5708696 - 5708647
Alignment:
| Q |
258 |
tctgataccactgaagggattttaagaggggtttttcaaaattttaatcct |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5708696 |
tctgataccactgaagggattttaagagggg-ttttcaaaattttaatcct |
5708647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 268 - 322
Target Start/End: Complemental strand, 26971811 - 26971758
Alignment:
| Q |
268 |
ctgaagggattttaagaggggtttttcaaaattttaatccttttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
26971811 |
ctgaagggattttaagaggggtttttcaaaattttaatcc-tctgcggaagaaat |
26971758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 269 - 322
Target Start/End: Original strand, 47387788 - 47387842
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47387788 |
tgaagggatttcaagaggggtttttcaaaattttaatcctctttgcggaagaaat |
47387842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 268 - 322
Target Start/End: Complemental strand, 5715320 - 5715266
Alignment:
| Q |
268 |
ctgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
5715320 |
ctgaagggattttaagagggg-ttttcaaaattttaatcctctttgcggaagaaat |
5715266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 272 - 322
Target Start/End: Original strand, 20579275 - 20579326
Alignment:
| Q |
272 |
agggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
20579275 |
agggattttaagaggggtttttcaaaaatttaatcctctttgcggaagaaat |
20579326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 322
Target Start/End: Complemental strand, 55614055 - 55614001
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||| |||||||||| |
|
|
| T |
55614055 |
tgaagggattttaagaggggtttttcaaaatttaaatcctctttacggaagaaat |
55614001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 271 - 322
Target Start/End: Complemental strand, 18270419 - 18270366
Alignment:
| Q |
271 |
aagggattttaagaggggt-ttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
18270419 |
aagggattttaagaggggttttttcaaaattttaatcctctttgcggaagaaat |
18270366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 322
Target Start/End: Complemental strand, 869968 - 869914
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||| || |||||||||||||| |
|
|
| T |
869968 |
tgaagggattttaagagggatttttcaaaaatttaattctctttgcggaagaaat |
869914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 258 - 322
Target Start/End: Original strand, 19925585 - 19925649
Alignment:
| Q |
258 |
tctgataccactgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||| ||||| ||||| |||| |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
19925585 |
tctgataccactgtaggga-tttaaaagggatttttcaaaaatttaatcctctttgcggaagaaat |
19925649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 269 - 308
Target Start/End: Complemental strand, 8859540 - 8859500
Alignment:
| Q |
269 |
tgaagggattttaagagggg-tttttcaaaattttaatcct |
308 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8859540 |
tgaagggattttaagagggggtttttcaaaattttaatcct |
8859500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 269 - 308
Target Start/End: Complemental strand, 35224903 - 35224864
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct |
308 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
35224903 |
tgaagggatttcaagagggggttttcaaaattttaatcct |
35224864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 10676409 - 10676461
Alignment:
| Q |
258 |
tctgataccac--tgaagggattttaagaggggtttttcaaaattttaatcct |
308 |
Q |
| |
|
||||||||||| ||||||||||| ||||||| ||||||||| |||||||||| |
|
|
| T |
10676409 |
tctgataccacattgaagggatttaaagagggttttttcaaatttttaatcct |
10676461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 10890049 - 10890101
Alignment:
| Q |
258 |
tctgataccac--tgaagggattttaagaggggtttttcaaaattttaatcct |
308 |
Q |
| |
|
||||||||||| ||||||||||| ||||||| ||||||||| |||||||||| |
|
|
| T |
10890049 |
tctgataccacattgaagggatttaaagagggttttttcaaatttttaatcct |
10890101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0203 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: scaffold0203
Description:
Target: scaffold0203; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 258 - 322
Target Start/End: Original strand, 29035 - 29100
Alignment:
| Q |
258 |
tctgataccactgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29035 |
tctgataccactgaagggattttaagaggggtttttcaaaattttaatcctctttgcggaagaaat |
29100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 58; Significance: 2e-24; HSPs: 10)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 258 - 322
Target Start/End: Original strand, 17690289 - 17690354
Alignment:
| Q |
258 |
tctgataccactgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17690289 |
tctgataccactgaagggattttaagaggggtttttcaaaattttaatcctctttgcggaagaaat |
17690354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 258 - 322
Target Start/End: Complemental strand, 29310248 - 29310183
Alignment:
| Q |
258 |
tctgataccactgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29310248 |
tctgataccactgaagggattttaagaggggtttttcaaaattttaatcctctttgcggaagaaat |
29310183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 258 - 322
Target Start/End: Complemental strand, 27298017 - 27297952
Alignment:
| Q |
258 |
tctgataccactgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
27298017 |
tctgataccactgaagggattttaagaggggtttttcaaaatattaatcctctttgcggaagaaat |
27297952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 264 - 322
Target Start/End: Original strand, 27380082 - 27380141
Alignment:
| Q |
264 |
accactgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
27380082 |
accactgaagggattttaagaggggtttttcaaaaatttaatcctctttgcggaagaaat |
27380141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 264 - 322
Target Start/End: Original strand, 27470465 - 27470524
Alignment:
| Q |
264 |
accactgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
27470465 |
accactgaagggattttaagaggggtttttcaaaaatttaatcctctttgcggaagaaat |
27470524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 269 - 322
Target Start/End: Complemental strand, 29317196 - 29317142
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29317196 |
tgaagggattttaagaggggtttttcaaaattttaatcctctttgcggaagaaat |
29317142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 267 - 322
Target Start/End: Complemental strand, 27278716 - 27278660
Alignment:
| Q |
267 |
actgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
27278716 |
actgaagggattttaagaggggtttttcaaaatattaatcctctttgcggaagaaat |
27278660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 267 - 322
Target Start/End: Complemental strand, 27303607 - 27303551
Alignment:
| Q |
267 |
actgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
27303607 |
actgaagggattttaagaggggtttttcaaaatattaatcctctttgcggaagaaat |
27303551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 268 - 322
Target Start/End: Complemental strand, 11653046 - 11652991
Alignment:
| Q |
268 |
ctgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
11653046 |
ctgaagggattttaagagggttttttcaaaattttaatcctctttgcggaagaaat |
11652991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 258 - 303
Target Start/End: Original strand, 16393328 - 16393373
Alignment:
| Q |
258 |
tctgataccactgaagggattttaagaggggtttttcaaaatttta |
303 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||| |||| |
|
|
| T |
16393328 |
tctgataccactgaagggattttgagaggagtttttcaaaaattta |
16393373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 19)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 258 - 322
Target Start/End: Original strand, 15606278 - 15606343
Alignment:
| Q |
258 |
tctgataccactgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15606278 |
tctgataccactgaagggattttaagaggggtttttcaaaattttaatcctctttgcggaagaaat |
15606343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 258 - 322
Target Start/End: Original strand, 10578180 - 10578246
Alignment:
| Q |
258 |
tctgataccactg-aagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10578180 |
tctgataccactggaagggattttaagaggggtttttcaaaattttaatcctctttgcggaagaaat |
10578246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 267 - 322
Target Start/End: Original strand, 15599742 - 15599798
Alignment:
| Q |
267 |
actgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15599742 |
actgaagggattttaagaggggtttttcaaaattttaatcctctttgcggaagaaat |
15599798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 262 - 322
Target Start/End: Complemental strand, 13212654 - 13212593
Alignment:
| Q |
262 |
ataccactgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
13212654 |
ataccactgaagggattttaagaggagtttttcaaaattttaatcctctttacggaagaaat |
13212593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 271 - 322
Target Start/End: Original strand, 10571427 - 10571479
Alignment:
| Q |
271 |
aagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10571427 |
aagggattttaagaggggtttttcaaaattttaatcctctttgcggaagaaat |
10571479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 269 - 322
Target Start/End: Complemental strand, 8491731 - 8491677
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
8491731 |
tgaagggattttaagaggggtttttcaaaaatttaatcctctttgcggaagaaat |
8491677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 269 - 322
Target Start/End: Complemental strand, 12564493 - 12564439
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
12564493 |
tgaagggattttaagaggggtttttcaaaattttaatcctctttacggaagaaat |
12564439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 269 - 322
Target Start/End: Complemental strand, 13258892 - 13258838
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
13258892 |
tgaagggattttaagaggggtttttcaaaattttaatcctctttacggaagaaat |
13258838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 269 - 322
Target Start/End: Complemental strand, 13692029 - 13691975
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13692029 |
tgaagggatttgaagaggggtttttcaaaattttaatcctctttgcggaagaaat |
13691975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 322
Target Start/End: Complemental strand, 6111446 - 6111393
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
6111446 |
tgaagggattttaagaggg-tttttcaaaattttaatcctctttgcggaagaaat |
6111393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 322
Target Start/End: Complemental strand, 13518156 - 13518102
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||| |||||||| |
|
|
| T |
13518156 |
tgaagggattttaagaggggtttttcaaaattttattcctctttgcagaagaaat |
13518102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 322
Target Start/End: Original strand, 16481318 - 16481372
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||| |||||||||| |
|
|
| T |
16481318 |
tgaagggattttaagaggggtttttcaaaatttaaatcctctttacggaagaaat |
16481372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 322
Target Start/End: Original strand, 17780025 - 17780078
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
17780025 |
tgaagggattttaagagggg-ttttcaaaattttaatcctctttgcggaagaaat |
17780078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 322
Target Start/End: Original strand, 19081326 - 19081379
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
19081326 |
tgaagggattttaagagggg-ttttcaaaattttaatcctctttgcggaagaaat |
19081379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 303
Target Start/End: Original strand, 15356433 - 15356478
Alignment:
| Q |
258 |
tctgataccactgaagggattttaagaggggtttttcaaaatttta |
303 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
15356433 |
tctgataccactgaagggattttaagagaggtttttccaaatttta |
15356478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 269 - 308
Target Start/End: Complemental strand, 18534984 - 18534945
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct |
308 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18534984 |
tgaagggattttaagagggatttttcaaaattttaatcct |
18534945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 269 - 308
Target Start/End: Complemental strand, 18538342 - 18538303
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct |
308 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
18538342 |
tgaagggattttaagagagatttttcaaaattttaatcct |
18538303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 274 - 308
Target Start/End: Original strand, 6288184 - 6288218
Alignment:
| Q |
274 |
ggattttaagaggggtttttcaaaattttaatcct |
308 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6288184 |
ggattttaaaaggggtttttcaaaattttaatcct |
6288218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 269 - 308
Target Start/End: Complemental strand, 25801508 - 25801468
Alignment:
| Q |
269 |
tgaagggattttaagaggggt-ttttcaaaattttaatcct |
308 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
25801508 |
tgaagggatttaaagaggggttttttcaaaattttaatcct |
25801468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 6e-22; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 258 - 322
Target Start/End: Complemental strand, 18253388 - 18253323
Alignment:
| Q |
258 |
tctgataccactgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
18253388 |
tctgataccactgaagggattttaagaggggtttttcaaaattttaatcctctttgcagaagaaat |
18253323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 269 - 322
Target Start/End: Original strand, 27130257 - 27130311
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27130257 |
tgaaaggattttaagaggggtttttcaaaattttaatcctctttgcggaagaaat |
27130311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 267 - 322
Target Start/End: Original strand, 27309410 - 27309467
Alignment:
| Q |
267 |
actgaagggattttaagagggg-tttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
27309410 |
actgaagggattttaagagggggtttttcaaaattttaatcctctttgcggaagaaat |
27309467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 272 - 322
Target Start/End: Original strand, 18531376 - 18531427
Alignment:
| Q |
272 |
agggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
18531376 |
agggattttaagagggatttttcaaaattttaatcctctttgcggaagaaat |
18531427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 303
Target Start/End: Original strand, 9075750 - 9075785
Alignment:
| Q |
268 |
ctgaagggattttaagaggggtttttcaaaatttta |
303 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9075750 |
ctgaagggatttaaagaggggtttttcaaaatttta |
9075785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 269 - 322
Target Start/End: Original strand, 21169283 - 21169338
Alignment:
| Q |
269 |
tgaagggattttaaga-ggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| ||||| |||||||||||||| |
|
|
| T |
21169283 |
tgaagggattttaagaggggggttttcaaaattttgatcctctttgcggaagaaat |
21169338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0234 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: scaffold0234
Description:
Target: scaffold0234; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 258 - 322
Target Start/End: Original strand, 10060 - 10126
Alignment:
| Q |
258 |
tctgataccactgaagggattttaagagggg-tttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
10060 |
tctgataccactgaagggattttaagaggggttttttcaaaattttaatcctctttgcggaagaaat |
10126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0234; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 268 - 322
Target Start/End: Original strand, 1177 - 1233
Alignment:
| Q |
268 |
ctgaagggattttaagagggg-tttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
1177 |
ctgaagggattttaagaggggttttttcaaaattttaatcctctttgcggaagaaat |
1233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 1e-19; HSPs: 12)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 258 - 322
Target Start/End: Original strand, 11541829 - 11541894
Alignment:
| Q |
258 |
tctgataccactgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |||||||||| |
|
|
| T |
11541829 |
tctgataccactgaagggattttaagagggttttttcaaaattttaatcctctttacggaagaaat |
11541894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 267 - 322
Target Start/End: Complemental strand, 15153817 - 15153761
Alignment:
| Q |
267 |
actgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15153817 |
actgaagggattttaagaggggtttttcaaaattttaatcctctttgcggaagaaat |
15153761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 216 - 258
Target Start/End: Original strand, 11541710 - 11541752
Alignment:
| Q |
216 |
acatgattatcgctcttgaatgatattcacaaattaataaatt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11541710 |
acatgattatcgctcttgaatgatattcacaaattaataaatt |
11541752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 258 - 322
Target Start/End: Original strand, 11557064 - 11557129
Alignment:
| Q |
258 |
tctgataccactgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||||||| | | |||||||||||||| |
|
|
| T |
11557064 |
tctgataccactgaagggattttaagagggggtttttaaaattttaaccgtctttgcggaagaaat |
11557129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 272 - 322
Target Start/End: Complemental strand, 9979174 - 9979123
Alignment:
| Q |
272 |
agggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
9979174 |
agggattttaagaggggtttttgaaaattttaatcctctttgcggaagaaat |
9979123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 273 - 322
Target Start/End: Original strand, 2652852 - 2652902
Alignment:
| Q |
273 |
gggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
2652852 |
gggattttaagaggggtttttcaaaattttaatcctctttacggaagaaat |
2652902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 322
Target Start/End: Complemental strand, 12752206 - 12752152
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
12752206 |
tgaatggattttaagaggggtttttcaaaattttaatcctctttacggaagaaat |
12752152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 322
Target Start/End: Complemental strand, 18562385 - 18562331
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || |||| ||||||||| |
|
|
| T |
18562385 |
tgaagggattttaagaggggtttttcaaaattttaatactctttgaggaagaaat |
18562331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 322
Target Start/End: Complemental strand, 29329135 - 29329081
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||| |||||||| |
|
|
| T |
29329135 |
tgaagggattttaagaggggattttcaaaattttaatcctctttgcagaagaaat |
29329081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 269 - 322
Target Start/End: Original strand, 11534921 - 11534976
Alignment:
| Q |
269 |
tgaagggattttaagagggg-tttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| ||| |||||||||| |
|
|
| T |
11534921 |
tgaagggattttaagaggggttttttcaaaattttaatcctctttacggaagaaat |
11534976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 262 - 322
Target Start/End: Complemental strand, 12739895 - 12739833
Alignment:
| Q |
262 |
ataccactgaagggattttaagaggggt-ttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||| |||||||||| || |||||||||||||| |
|
|
| T |
12739895 |
ataccacttaagggattttaagaggggttttttcgaaattttaattctctttgcggaagaaat |
12739833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 271 - 308
Target Start/End: Original strand, 18256679 - 18256716
Alignment:
| Q |
271 |
aagggattttaagaggggtttttcaaaattttaatcct |
308 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
18256679 |
aagggatttaaagaggggtttttcaaaaatttaatcct |
18256716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0433 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0433
Description:
Target: scaffold0433; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 268 - 322
Target Start/End: Complemental strand, 8456 - 8401
Alignment:
| Q |
268 |
ctgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8456 |
ctgaagggattttaagaggggtttttcaaaattttaatcctctttgcggaagaaat |
8401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0657 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0657
Description:
Target: scaffold0657; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 262 - 322
Target Start/End: Complemental strand, 4071 - 4010
Alignment:
| Q |
262 |
ataccactgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
4071 |
ataccactgaagggattttaagaggagtttttcaaaattttaatcctctttacggaagaaat |
4010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 8)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 216 - 258
Target Start/End: Complemental strand, 24637154 - 24637112
Alignment:
| Q |
216 |
acatgattatcgctcttgaatgatattcacaaattaataaatt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24637154 |
acatgattatcgctcttgaatgatattcacaaattaataaatt |
24637112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 322
Target Start/End: Complemental strand, 6095492 - 6095439
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
6095492 |
tgaagggattttaagaggg-tttttcaaaattttaatcctctttgcggaagaaat |
6095439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 271 - 308
Target Start/End: Complemental strand, 21942012 - 21941975
Alignment:
| Q |
271 |
aagggattttaagaggggtttttcaaaattttaatcct |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21942012 |
aagggattttaagaggggtttttcaaaattttaatcct |
21941975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 322
Target Start/End: Complemental strand, 15327569 - 15327516
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15327569 |
tgaagggattt-aagagaggtttttcaaaattttaatcctctttgcggaagaaat |
15327516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 322
Target Start/End: Complemental strand, 15507938 - 15507885
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15507938 |
tgaagggattt-aagagaggtttttcaaaattttaatcctctttgcggaagaaat |
15507885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 322
Target Start/End: Original strand, 27660698 - 27660752
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||| || ||||||||||| |
|
|
| T |
27660698 |
tgaaaggattttaagagaggtttttcaaaattttaatcctcttagcggaagaaat |
27660752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 275 - 308
Target Start/End: Original strand, 24795853 - 24795886
Alignment:
| Q |
275 |
gattttaagaggggtttttcaaaattttaatcct |
308 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
24795853 |
gattttaagaggggttattcaaaattttaatcct |
24795886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 275 - 322
Target Start/End: Complemental strand, 28549376 - 28549327
Alignment:
| Q |
275 |
gattttaagag-gggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
28549376 |
gattttaagagagggtttttcacaattttaatcctctttgcggaagaaat |
28549327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1383 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: scaffold1383
Description:
Target: scaffold1383; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 258 - 303
Target Start/End: Complemental strand, 49 - 4
Alignment:
| Q |
258 |
tctgataccactgaagggattttaagaggggtttttcaaaatttta |
303 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49 |
tctgataccactgaagggattttaagagaggtttttcaaaatttta |
4 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1199 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold1199
Description:
Target: scaffold1199; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 269 - 308
Target Start/End: Complemental strand, 472 - 433
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
472 |
tgaagggattttaagaggggtttttcaaaattttaatcct |
433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 258 - 323
Target Start/End: Original strand, 229231 - 229298
Alignment:
| Q |
258 |
tctgataccactgaagggatttta-agaggggtttttcaaaattttaatcct-tttgcggaagaaatt |
323 |
Q |
| |
|
|||||||||||||||||||||| | |||||| |||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
229231 |
tctgataccactgaagggatttaatagagggttttttccaaattttaatcctctttgcggaagaaatt |
229298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0390 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0390
Description:
Target: scaffold0390; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 258 - 322
Target Start/End: Original strand, 12773 - 12839
Alignment:
| Q |
258 |
tctgataccactgaagggattttaagaggggtttttc-aaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||||| ||||||||| |||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
12773 |
tctgataccactgtagggattttgagagaggtttttcaaaaattttaatcctctttgcggaagaaat |
12839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0220 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0220
Description:
Target: scaffold0220; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 322
Target Start/End: Complemental strand, 19660 - 19606
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
19660 |
tgaagggattttaagaggagtttttcaaaaatttaatcctctttgcggaagaaat |
19606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 322
Target Start/End: Complemental strand, 18621184 - 18621130
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
18621184 |
tgaagggattttaagaagggtttttcaaaattttaatcctctttgcggaataaat |
18621130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0705 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0705
Description:
Target: scaffold0705; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 303
Target Start/End: Original strand, 7486 - 7531
Alignment:
| Q |
258 |
tctgataccactgaagggattttaagaggggtttttcaaaatttta |
303 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
7486 |
tctgataccactgaagggattttaagagaggtttttccaaatttta |
7531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0213 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0213
Description:
Target: scaffold0213; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 4588 - 4548
Alignment:
| Q |
268 |
ctgaagggattttaagaggggtttttcaaaattttaatcct |
308 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4588 |
ctgaagggattttgagaggggtttttcaaaattttaatcct |
4548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0063 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0063
Description:
Target: scaffold0063; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 269 - 322
Target Start/End: Complemental strand, 6877 - 6822
Alignment:
| Q |
269 |
tgaagggatttta-agaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6877 |
tgaagggatttaatagaggggtttttcaaaattttaatcctctttgcggaagaaat |
6822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 272 - 322
Target Start/End: Complemental strand, 26557 - 26506
Alignment:
| Q |
272 |
agggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
26557 |
aggggttttaagaggggtttttcaaaattttaatcctctttacggaagaaat |
26506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000005; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 258 - 322
Target Start/End: Original strand, 24694309 - 24694374
Alignment:
| Q |
258 |
tctgataccactgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||| ||||| |||||| |||||||| ||||||||||| ||| |||||||||| |
|
|
| T |
24694309 |
tctgataccactgaagagatttaaagaggtgtttttcatgattttaatcctctttacggaagaaat |
24694374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 258 - 322
Target Start/End: Original strand, 24701078 - 24701143
Alignment:
| Q |
258 |
tctgataccactgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaat |
322 |
Q |
| |
|
|||||||||||||||| ||||| |||||| |||||||| ||||||||||| ||| |||||||||| |
|
|
| T |
24701078 |
tctgataccactgaagagatttaaagaggtgtttttcatgattttaatcctctttacggaagaaat |
24701143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 308
Target Start/End: Original strand, 22546232 - 22546264
Alignment:
| Q |
276 |
attttaagaggggtttttcaaaattttaatcct |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
22546232 |
attttaagaggggtttttcaaaattttaatcct |
22546264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 273 - 305
Target Start/End: Original strand, 938385 - 938417
Alignment:
| Q |
273 |
gggattttaagaggggtttttcaaaattttaat |
305 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
938385 |
gggattttaaggggggtttttcaaaattttaat |
938417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 88059 - 88004
Alignment:
| Q |
269 |
tgaagggattttaagaggggtttttcaaaattttaatcct-tttgcggaagaaatt |
323 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||| | ||||||||||||| |
|
|
| T |
88059 |
tgaagggattttaagaggggtttttccaatctttaatcctctatgcggaagaaatt |
88004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University