View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7882_high_10 (Length: 241)
Name: NF7882_high_10
Description: NF7882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7882_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 4 - 222
Target Start/End: Complemental strand, 4374532 - 4374313
Alignment:
| Q |
4 |
agagagaaattcttttggccatactatcatcggcaaagtccatttcatgaccatttccttgatgtgcatcaagatcaataattatcaccctgaagattat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4374532 |
agagagaaattcttttggccatactatcatcggcaaagtccatttcatgaccatttccttgatgtgcatcaagatcaataattatcaccctgaagattat |
4374433 |
T |
 |
| Q |
104 |
acagacaattttgcacaggtgttaatagaataagcgaaccggcaat-ttttattttaaagtctaaatgtgatagaaccttgatatattcaactgaacaaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4374432 |
acagacaattttgcacaggtgttaatagaataagcgaaccggcaattttttattttaaagtctaaatgtgatagaaccttgatatattcaactgaacaaa |
4374333 |
T |
 |
| Q |
203 |
agcaaagtggatgcatagag |
222 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
4374332 |
agcaaagtggatgcatagag |
4374313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University