View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7882_low_10 (Length: 295)
Name: NF7882_low_10
Description: NF7882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7882_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 13 - 278
Target Start/End: Complemental strand, 1078356 - 1078091
Alignment:
| Q |
13 |
aatatcctaactaagggattttgtttttgtcaattaaaattgggtttttgtttccctaatgattgtttgttgggtctcaagtattatcaaaactattttt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1078356 |
aatatcctaactaagggattttgtttttgtcaattaaaattgggtttttgttttcctaatgattgtttgttgggtctcaagtattatcaaaactattttt |
1078257 |
T |
 |
| Q |
113 |
aatattccacttccatcattcaaaagaaactattagcggcttcataaatttctccactaagcaagtagcatctacttgaattaactatcttgtttagggc |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1078256 |
aatattccacttccatcattcagaagaaactattagcggcttcataaatttctccactaagcaagtagcatctacttgaattaactatcttgtttagggc |
1078157 |
T |
 |
| Q |
213 |
ttttctagcacctttgtgtcacataccaaatggagaaggagaatattgtggctttttctaacacat |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1078156 |
ttttctagcacctttgtgtcacataccaaatggagaaggagaatattgtggctttttctaacacat |
1078091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University