View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7883_high_16 (Length: 240)
Name: NF7883_high_16
Description: NF7883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7883_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 231
Target Start/End: Complemental strand, 35380042 - 35379829
Alignment:
| Q |
18 |
attctatcaacattttagttgatggtggttttgcatggtcttttttggaaagattctgctttttaagtgacaacatactttaactaaaagaaagaaagag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35380042 |
attctatcaacattttagttgatggtggttttgcatggtcttttttggaaagattctgctttttaagtgacaacatactttaactaaaagaaagaaagag |
35379943 |
T |
|
| Q |
118 |
cagaaggtgaaagattaattcagtaaaaatggaggggggctactctgaccaacccctcaccttctttatgttgatcacatgcacatccatgcatttcact |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
35379942 |
cagaaggtgaaagattaattcagtaaaaatggaggggggctcctctgaccaacccttcaccttctttatgttgatcacatgcacatccatgcatttccct |
35379843 |
T |
|
| Q |
218 |
attggtccctccat |
231 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
35379842 |
attggtccctccat |
35379829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University