View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7883_high_17 (Length: 217)
Name: NF7883_high_17
Description: NF7883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7883_high_17 |
 |  |
|
| [»] scaffold0386 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 15 - 202
Target Start/End: Complemental strand, 6074578 - 6074393
Alignment:
| Q |
15 |
aagaaagaaaaaggttttgatgcttctcttttgaattataggaatgttcaatctcgacaagtgatggtttatatgattcaacatttgccacatcttcatc |
114 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6074578 |
aagaaagaaaaaggttt--atgcttctcttttgaattataggaatgttcaatctcgacaagtgatggtttatatgattcaacatttgccacatcttcatc |
6074481 |
T |
 |
| Q |
115 |
tttgaataatctctattaagacgatattggatgtgaatattgtgtcggttaagaattacaattgtttatggttgatgcatcttggtaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6074480 |
tttgaataatctctattaagacgatattggatgtgaatattgtgtcggctaaggattacaattgtttatggttgatgcatcttggtaa |
6074393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 15 - 198
Target Start/End: Complemental strand, 6070048 - 6069867
Alignment:
| Q |
15 |
aagaaagaaaaaggttttgatgcttctcttttgaattataggaatgttcaatctcgacaagtgatggtttatatgattcaacatttgccacatcttcatc |
114 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
6070048 |
aagaaagaaaaaggtg--gatgcttctcttttgaattataggaatgttcaagctcgacaagtgatagtctatatgattcaacatttgccacatcttcatc |
6069951 |
T |
 |
| Q |
115 |
tttgaataatctctattaagacgatattggatgtgaatattgtgtcggttaagaattacaattgtttatggttgatgcatcttg |
198 |
Q |
| |
|
||| ||| |||||||| |||| | ||||||||||||||||||||||| |||| |||||||||||| ||||||||||||||||| |
|
|
| T |
6069950 |
ttttgatactctctattcagacaaaattggatgtgaatattgtgtcggctaaggattacaattgttcatggttgatgcatcttg |
6069867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0386 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: scaffold0386
Description:
Target: scaffold0386; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 13 - 113
Target Start/End: Complemental strand, 1458 - 1360
Alignment:
| Q |
13 |
agaagaaagaaaaaggttttgatgcttctcttttgaattataggaatgttcaatctcgacaagtgatggtttatatgattcaacatttgccacatcttca |
112 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| ||| ||||||||||||||||||| ||||||||| |
|
|
| T |
1458 |
agaagaaagaaaaaggtt--gatgcttctcttttgaattataggaatgttcaagctcgacaagtgacggtctatatgattcaacatttgctacatcttca |
1361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0386; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 140 - 187
Target Start/End: Complemental strand, 650 - 603
Alignment:
| Q |
140 |
attggatgtgaatattgtgtcggttaagaattacaattgtttatggtt |
187 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
650 |
attggatgtgaatattgtgtcggctaaggattacaattgtttatggtt |
603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University