View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7883_low_25 (Length: 223)
Name: NF7883_low_25
Description: NF7883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7883_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 55 - 203
Target Start/End: Complemental strand, 14197568 - 14197421
Alignment:
| Q |
55 |
gtaggattgttctttaatcggtctattcattggtctgctcgtcgtcctgatctatttatggatgttattattgcatttgatttaatggaaaggacacttt |
154 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
14197568 |
gtaggtttgttctttaatgggtctattcattggtcggctcgtcgtcctgatctatttatggatgttattattgcatttgatttaatggaacggacacatt |
14197469 |
T |
|
| Q |
155 |
ttcatatccctttttcagattgtttttaccatgaacctagggattaggg |
203 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14197468 |
ttcatatccc-tttccagattgtttttaccatgaacctagggattaggg |
14197421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 16 - 64
Target Start/End: Complemental strand, 14197633 - 14197585
Alignment:
| Q |
16 |
ataatacttggaaagaacttgaggcatctcgcaccacttgtaggattgt |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14197633 |
ataatacttggaaagaacttgaggcatctcgcaccacttgtaggattgt |
14197585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 114 - 180
Target Start/End: Complemental strand, 48147562 - 48147496
Alignment:
| Q |
114 |
ggatgttattattgcatttgatttaatggaaaggacactttttcatatccctttttcagattgtttt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| | || |||||| ||||| ||||| |
|
|
| T |
48147562 |
ggatgttattattgcatttgatttaatggaaaggagacttttagagatgccttttccagatggtttt |
48147496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 113 - 174
Target Start/End: Complemental strand, 45366070 - 45366009
Alignment:
| Q |
113 |
tggatgttattattgcatttgatttaatggaaaggacactttttcatatccctttttcagat |
174 |
Q |
| |
|
|||||||||||||| | ||||||||||| ||||||| ||||||| |||| | |||| ||||| |
|
|
| T |
45366070 |
tggatgttattatttcctttgatttaatcgaaaggaaacttttttatattcattttccagat |
45366009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 112 - 199
Target Start/End: Complemental strand, 11024348 - 11024261
Alignment:
| Q |
112 |
atggatgttattattgcatttgatttaatggaaaggacactttttcatatccctttttcagattgtttttaccatgaacctagggatt |
199 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||| |||||| | || |||||| ||||| ||||| | |||||||||| ||||| |
|
|
| T |
11024348 |
atggatgttattattgcctttgatttagtggaaagggaacttttggagatgccttttccagatggttttgatcatgaacctatggatt |
11024261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 80 - 148
Target Start/End: Complemental strand, 4962406 - 4962338
Alignment:
| Q |
80 |
ttcattggtctgctcgtcgtcctgatctatttatggatgttattattgcatttgatttaatggaaagga |
148 |
Q |
| |
|
|||||||| |||||||||| |||| ||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4962406 |
ttcattgggttgctcgtcgtaatgatttatcagtggatgttattattgtctttgatttaatggaaagga |
4962338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 152
Target Start/End: Complemental strand, 41311208 - 41311168
Alignment:
| Q |
112 |
atggatgttattattgcatttgatttaatggaaaggacact |
152 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||| |||||| |
|
|
| T |
41311208 |
atggatgttattattgcctttgatttaaaggaaatgacact |
41311168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University