View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7885_low_18 (Length: 223)
Name: NF7885_low_18
Description: NF7885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7885_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 38927455 - 38927666
Alignment:
| Q |
1 |
atctttcctcgtccggtttctctgttgattctctcttgaagtgcttgagagaaatggaaaagaagtctctgaactgtgcttccaatatttccactttcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38927455 |
atctttcctcgtccggtttctctgttgattctctcttgaagggcttgagagaaatggaaaagaagtctctgaactgtgcttccaatatttccactttcat |
38927554 |
T |
|
| Q |
101 |
tcatgagatgaaaatgtgaaagtaacatgtttgcacgttcaaattgttgacaacctactctctcagctgctgctagaacaaactgagctagttcaacttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38927555 |
tcatgagatgaaaatgtgaaagtaacatgtttgcacgttcaaattgttgacaacctactctctcagctgctgctagaacaaactgagctagttcaacttg |
38927654 |
T |
|
| Q |
201 |
tttatattcttc |
212 |
Q |
| |
|
||||| |||||| |
|
|
| T |
38927655 |
tttattttcttc |
38927666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University