View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7888_low_1 (Length: 304)
Name: NF7888_low_1
Description: NF7888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7888_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 9e-30; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 99 - 196
Target Start/End: Complemental strand, 1871050 - 1870948
Alignment:
| Q |
99 |
atatttaaaaccgatctag-----actactctacttgccattaccagtcgattaacgggtccaaaagaaaagtgactaaacgggtaatttctaggaactt |
193 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| |||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1871050 |
atatttaaaaccgatcgagacagcactactctacttgccattactagtcgattaatgggtccaaaagaaaagtgactcaacgggtaatttctaggaactt |
1870951 |
T |
|
| Q |
194 |
agc |
196 |
Q |
| |
|
||| |
|
|
| T |
1870950 |
agc |
1870948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 1871145 - 1871110
Alignment:
| Q |
1 |
ttaatactaccaattaaattttatatttattctttc |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
1871145 |
ttaatactaccaattaaattttatatttattctttc |
1871110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 214 - 251
Target Start/End: Complemental strand, 1850476 - 1850439
Alignment:
| Q |
214 |
gagaagattaagtcgaaccattaattgaatcgaaaaca |
251 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1850476 |
gagaagattaagttgaaccattaattgaatcgaaaaca |
1850439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 209
Target Start/End: Complemental strand, 1850564 - 1850511
Alignment:
| Q |
156 |
aaaagaaaagtgactaaacgggtaatttctaggaacttagctgcttgtctcttc |
209 |
Q |
| |
|
|||| |||||||||| || ||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
1850564 |
aaaaaaaaagtgactcaaagggtaatttctagcaacgtagcttcttgtctcttc |
1850511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University