View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7890_low_12 (Length: 250)
Name: NF7890_low_12
Description: NF7890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7890_low_12 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 9 - 250
Target Start/End: Original strand, 41989358 - 41989599
Alignment:
| Q |
9 |
tcgtgttgtctatgttctgaggtcttactcataatttggctctagtcnnnnnnnnnnnnnnnnaaactagtactataatgtactcataaatataagatta |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41989358 |
tcgtgttgtctatgttctgaggtcttactcataatttggctctagtctttattttttatttttaaactagtactataatgtactcataaatataagatta |
41989457 |
T |
|
| Q |
109 |
cataattgaaggaataagttgccgaaagctataccataattataactagcaagaatttagtccaagctttttagaaaaaggattattacctttttaatat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41989458 |
cataattgaaggaataagttgccgaaagctataccataattataactagcaagaatttagtccaagctttttagaaaaaggattattacctttttaatat |
41989557 |
T |
|
| Q |
209 |
tggatgtagaaagtgatttgaaagcctttatatgtgctgaaa |
250 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41989558 |
tggatgtagaaactgatttgaaagcctttatatgtgctgaaa |
41989599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University