View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7890_low_13 (Length: 248)
Name: NF7890_low_13
Description: NF7890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7890_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 41989618 - 41989849
Alignment:
| Q |
1 |
attttgttctattgattaactgtaagtagtctataatcccccaaattatgcnnnnnnngccgtcaaaatggagaacaaattatactatcattccttctta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41989618 |
attttgttctattgattaactgtaagtagtctataatcccccaaattatgctttttttgccgtcaaaatggagaacaaattatactatcattccttctta |
41989717 |
T |
|
| Q |
101 |
tgaattaaaagttctctcattcttttctgaccataacacttgatttgttgtgcatagtttattatgaactttaccaatatatataagtg-aaaaattgtt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||| |
|
|
| T |
41989718 |
tgaattaaaagttctctcattcttttctgaccataacacttgatttgttgtgcatagtttattatgaactttaccaatatatacaagtgaaaaaagtgtt |
41989817 |
T |
|
| Q |
200 |
acat-aaattttctcattgtgaccggggatcc |
230 |
Q |
| |
|
|| | |||||||||||| |||||||||||||| |
|
|
| T |
41989818 |
acttgaaattttctcatagtgaccggggatcc |
41989849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University