View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7890_low_15 (Length: 242)
Name: NF7890_low_15
Description: NF7890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7890_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 23865941 - 23865738
Alignment:
| Q |
18 |
ataaggagaataataataaatgcctttgggacatttattaaagtactaaaataagtaggtttgcatnnnnnnngttggtttttatgttctgagaaacttt |
117 |
Q |
| |
|
||||||||||| |||| ||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23865941 |
ataaggagaatgctaatgaatgcctttggaacatttattaaagtactaaaataagtaggtttgcataaaaaa-gttggtttttatgttctgagaaacttt |
23865843 |
T |
 |
| Q |
118 |
ggactggcaggtgtggttgggtatggtttagtctgttcgccgattgctgcatatatctgggtttatggttggttttggagtggtgaattggcagcagaat |
217 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23865842 |
ggaatggcaggtgtggttgggtatggtttagtctgttcgccgattgctgcatatatctgtgtttatggttggttttggagtggtgaactggcagcagaat |
23865743 |
T |
 |
| Q |
218 |
gtgat |
222 |
Q |
| |
|
||||| |
|
|
| T |
23865742 |
gtgat |
23865738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 131 - 222
Target Start/End: Original strand, 23359300 - 23359392
Alignment:
| Q |
131 |
tggttgggtatggtttagtctgt-tcgccgattgctgcatatatctgggtttatggttggttttggagtggtgaattggcagcagaatgtgat |
222 |
Q |
| |
|
||||| |||| |||||||||| | | || |||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23359300 |
tggttcggtacggtttagtctctctggctgattgctgcatatatctgtgtttctggttggttttggagtggtgaattggcagcagaaggtgat |
23359392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 131 - 222
Target Start/End: Original strand, 23364121 - 23364213
Alignment:
| Q |
131 |
tggttgggtatggtttagtctgt-tcgccgattgctgcatatatctgggtttatggttggttttggagtggtgaattggcagcagaatgtgat |
222 |
Q |
| |
|
||||| |||| |||||||||| | | || |||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23364121 |
tggttcggtacggtttagtctctctggctgattgctgcatatatctgtgtttctggttggttttggagtggtgaattggcagcagaaggtgat |
23364213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 131 - 222
Target Start/End: Original strand, 23694599 - 23694691
Alignment:
| Q |
131 |
tggttgggtatggtttagtctgt-tcgccgattgctgcatatatctgggtttatggttggttttggagtggtgaattggcagcagaatgtgat |
222 |
Q |
| |
|
||||| |||| |||||||||| | | || |||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23694599 |
tggttcggtacggtttagtctctctggctgattgctgcatatatctgtgtttctggttggttttggagtggtgaattggcagcagaaggtgat |
23694691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 131 - 222
Target Start/End: Original strand, 23713039 - 23713131
Alignment:
| Q |
131 |
tggttgggtatggtttagtctgt-tcgccgattgctgcatatatctgggtttatggttggttttggagtggtgaattggcagcagaatgtgat |
222 |
Q |
| |
|
||||| |||| |||||||||| | | || |||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23713039 |
tggttcggtacggtttagtctctctggctgattgctgcatatatctgtgtttctggttggttttggagtggtgaattggcagcagaaggtgat |
23713131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 131 - 222
Target Start/End: Original strand, 23731495 - 23731587
Alignment:
| Q |
131 |
tggttgggtatggtttagtctgt-tcgccgattgctgcatatatctgggtttatggttggttttggagtggtgaattggcagcagaatgtgat |
222 |
Q |
| |
|
||||| |||| |||||||||| | | || |||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23731495 |
tggttcggtacggtttagtctctctggctgattgctgcatatatctgtgtttctggttggttttggagtggtgaattggcagcagaaggtgat |
23731587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 131 - 222
Target Start/End: Original strand, 23749950 - 23750042
Alignment:
| Q |
131 |
tggttgggtatggtttagtctgt-tcgccgattgctgcatatatctgggtttatggttggttttggagtggtgaattggcagcagaatgtgat |
222 |
Q |
| |
|
||||| |||| |||||||||| | | || |||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23749950 |
tggttcggtacggtttagtctctctggctgattgctgcatatatctgtgtttctggttggttttggagtggtgaattggcagcagaaggtgat |
23750042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 40 - 80
Target Start/End: Original strand, 47510735 - 47510775
Alignment:
| Q |
40 |
cctttgggacatttattaaagtactaaaataagtaggtttg |
80 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||| ||||| |
|
|
| T |
47510735 |
cctttggggcattgattaaagtactaaaataagtaagtttg |
47510775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 54335301 - 54335236
Alignment:
| Q |
18 |
ataaggagaataataataaatgcctttgggacatttattaaagtactaaaataagtaggtttgcat |
83 |
Q |
| |
|
|||||||||||| ||||| || | ||||| |||| |||||||||||||||||||| |||||||| |
|
|
| T |
54335301 |
ataaggagaatactaatatgtgtcattggggcattggttaaagtactaaaataagtaagtttgcat |
54335236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University